Mature sequence cin-miR-4026-5p

Accession numberMIMAT0016542
IDcin-miR-4026-5p
Stem-Loop cin-mir-4026
Sequence
guaagugaugacgucauuug
Get sequence
Deep sequencing8 reads, 2 experiments

References

1