Mature sequence cin-miR-4085-3p

Accession numberMIMAT0016660
IDcin-miR-4085-3p
Stem-Loop cin-mir-4085
Sequence
ugcuguguuguccaauugug
Get sequence
Deep sequencing reads, experiments

References

1