Mature sequence cin-miR-4112-5p

Accession numberMIMAT0016701
IDcin-miR-4112-5p
Stem-Loop cin-mir-4112
Sequence
auacauucauuuugacauac
Get sequence
Deep sequencing2 reads, 1 experiments

References

1