Mature sequence bta-miR-2284x

Accession numberMIMAT0017395
IDbta-miR-2284x
Stem-Loop bta-mir-2284x
Sequence
ugaaaaguucguucggguuuu
Get sequence
Deep sequencing170883 reads, 77 experiments
Predicted targets

References

1
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).
2
3
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).