Mature sequence aly-miR162a-3p

Accession numberMIMAT0017446
IDaly-miR162a-3p
Previous IDsaly-miR162a
Stem-Loop aly-MIR162a
Sequence
ucgauaaaccucugcauccag
Get sequence
Deep sequencing106 reads, 1 experiments
Database links
QuickGO function

References

1
2
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).