Mature sequence aly-miR171a-3p

Accession numberMIMAT0017516
IDaly-miR171a-3p
Previous IDsaly-miR171a
Stem-Loop aly-MIR171a
Sequence
ugauugagccgcgccaauauc
Get sequence
Deep sequencing92 reads, 1 experiments
Database links
QuickGO function

References

1
2
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).