Mature sequence aly-miR3434-3p

Accession numberMIMAT0017698
IDaly-miR3434-3p
Previous IDsaly-miR3434
Stem-Loop aly-MIR3434
Sequence
ucaaaaucagagaaucaacca
Get sequence
Deep sequencing10 reads, 1 experiments

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).