Mature sequence rno-miR-1949

Accession numberMIMAT0017852
IDrno-miR-1949
Stem-Loop rno-mir-1949
Sequence
uauaccaggaugucagcauaguu
Get sequence
Deep sequencing569 reads, 238 experiments
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).