Mature sequence aly-miR4235

Accession numberMIMAT0017924
IDaly-miR4235
Stem-Loop aly-MIR4235
Sequence
acugaaaacacuacaaccccu
Get sequence
Deep sequencing reads, experiments

References

1