Mature sequence aly-miR4242

Accession numberMIMAT0017931
IDaly-miR4242
Stem-Loop aly-MIR4242
Sequence
aaaguuaacuauggcauuccc
Get sequence
Deep sequencing reads, experiments

References

1