Mature sequence gma-miR159d

Accession numberMIMAT0018340
IDgma-miR159d
Stem-Loop gma-MIR159d
Sequence
agcugcuuagcuauggauccc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).