Mature sequence cel-miR-794-3p

Accession numberMIMAT0020352
IDcel-miR-794-3p
Previous IDscel-miR-794*
Stem-Loop cel-mir-794
Sequence
ugaaaacguugucuaucucgaa
Get sequence
Deep sequencing37 reads, 9 experiments
Database links
QuickGO function

References

1
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
2
3