Mature sequence bdi-miR395h-3p

Accession numberMIMAT0020748
IDbdi-miR395h-3p
Stem-Loop bdi-MIR395h
Sequence
ugaaguguuugggggaacuc
Get sequence
Deep sequencing reads, experiments

References

1
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).