Mature sequence hsa-miR-1247-3p

Accession numberMIMAT0022721
IDhsa-miR-1247-3p
Stem-Loop hsa-mir-1247
Sequence
ccccgggaacgucgagacuggagc
Get sequence
Deep sequencing1079 reads, 109 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).