Mature sequence osa-miR172d-5p

Accession numberMIMAT0022885
IDosa-miR172d-5p
Stem-Loop osa-MIR172d
Sequence
gcagcaccaucaagauucac
Get sequence
Deep sequencing41 reads, 2 experiments
Database links
QuickGO function

References

1
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).