Mature sequence gma-miR156y

Accession numberMIMAT0024884
IDgma-miR156y
Stem-Loop gma-MIR156y
Sequence
ugacagaagagagugagcac
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).