Mature sequence bta-miR-411c-5p

Accession numberMIMAT0025545
IDbta-miR-411c-5p
Stem-Loop bta-mir-411c
Sequence
gguugaucagagaacauacauu
Get sequence
Deep sequencing5051 reads, 63 experiments
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).