Mature sequence bta-miR-133c

• Accession number: MIMAT0029949
• ID: bta-miR-133c
• Stem-Loop: bta-mir-133c
• Sequence: auuugguuccauuuuaccagc
• Deep sequencing: reads, experiments
• Predicted targets:
  • TargetScanVert:bta-miR-133c

References

1. PMID:23100578 "Profiling of differentially expressed microRNA and the bioinformatic target gene analyses in bovine fast- and slow-type muscles by massively parallel sequencing" Muroya S, Taniguchi M, Shibata M, Oe M, Ojima K, Nakajima I, Chikuni K J Anim Sci. 91:90-103(2013).