Mature sequence gma-miR5041-3p

Accession numberMIMAT0032122
IDgma-miR5041-3p
Stem-Loop gma-MIR5041
Sequence
guugagcaaguugaagaugaa
Get sequence
Deep sequencing reads, experiments

References

1
2