Mature sequence cel-miR-8188-3p

Accession numberMIMAT0032790
IDcel-miR-8188-3p
Stem-Loop cel-mir-8188
Sequence
caguagacacuugcgaaauaugc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).