Mature sequence tae-miR9657a-3p

Accession numberMIMAT0035765
IDtae-miR9657a-3p
Stem-Loop tae-MIR9657a
Sequence
ugugcuuccucgucgaacggu
Get sequence
Deep sequencing30123 reads, 116 experiments

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).