Mature sequence tae-miR2275-3p

Accession numberMIMAT0035777
IDtae-miR2275-3p
Stem-Loop tae-MIR2275
Sequence
uuugguuuccuccaauaucucg
Get sequence
Deep sequencing7 reads, 6 experiments

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).