Mature sequence tae-miR1130b-3p

Accession numberMIMAT0035796
IDtae-miR1130b-3p
Stem-Loop tae-MIR1130b
Sequence
ucuuauauuaugggacggagg
Get sequence
Deep sequencing130657 reads, 116 experiments

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).