Mature sequence chi-miR-124a

Accession numberMIMAT0035922
IDchi-miR-124a
Stem-Loop chi-mir-124a
Sequence
uaaggcacgcggugaaugcc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).