Mature sequence chi-miR-196b

Accession numberMIMAT0036033
IDchi-miR-196b
Stem-Loop chi-mir-196b
Sequence
uagguaguuuccuguuguugg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).