Mature sequence chi-miR-381

Accession numberMIMAT0036199
IDchi-miR-381
Stem-Loop chi-mir-381
Sequence
uauacaagggcaagcucucugu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).