Mature sequence ssc-miR-375

Accession numberMIMAT0041608
IDssc-miR-375
Stem-Loop ssc-mir-375
Sequence
uuuguucguucggcucgcguga
Get sequence
Deep sequencing239 reads, 11 experiments

References

1
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).