Mature sequence gma-miR10408

• Accession number: MIMAT0041644
• ID: gma-miR10408
• Stem-Loop: gma-MIR10408
• Sequence: cgaggacuccuuuaaauagacu
• Deep sequencing: reads, experiments

References

1. PMID:25747880 "Evolutionary patterns and coevolutionary consequences of MIRNA genes and microRNA targets triggered by multiple mechanisms of genomic duplications in soybean" Zhao M, Meyers BC, Cai C, Xu W, Ma J Plant Cell. 27:546-562(2015).