Mature sequence gma-miR399l

Accession numberMIMAT0041678
IDgma-miR399l
Stem-Loop gma-MIR399l
Sequence
ugccaaaggagagcugcccug
Get sequence
Deep sequencing reads, experiments

References

1