Mature sequence sly-miR399b

Accession numberMIMAT0042016
IDsly-miR399b
Stem-Loop sly-MIR399b
Sequence
gggcuacucucuauuggcaug
Get sequence
Deep sequencing reads, experiments

References

1