Stem-loop sequence cel-mir-47

AccessionMI0000018 (change log)
DescriptionCaenorhabditis elegans miR-47 stem-loop
Gene family MIPF0000087; mir-46
Literature search

5 open access papers mention cel-mir-47
(16 sentences)

Stem-loop 
   gaga   -   ugaaa           a    -au       --c    ac 
5'     gcc gac     cugaagagagc gucu   ugacagu   gguu  u
       ||| |||     ||||||||||| ||||   |||||||   ||||   
3'     cgg cug     gacuucucucg cgga   acuguca   cuaa  c
   --cc   u   uagua           -    ggu       uuu    ag
Get sequence
Deep sequencing
58693 reads, 724 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 13921250-13921346 [+]
intergenic
Database links

Mature sequence cel-miR-47-5p

Accession MIMAT0015097
Previous IDscel-miR-47*
Sequence

19 -  

aagagagcagucuauugacagu

 - 40

Get sequence
Deep sequencing12122 reads, 15 experiments
Evidence experimental; CLIPseq [7]
Database links
Predicted targets

Mature sequence cel-miR-47-3p

Accession MIMAT0000018
Previous IDscel-miR-47
Sequence

61 -  

ugucauggaggcgcucucuuca

 - 82

Get sequence
Deep sequencing46550 reads, 17 experiments
Evidence experimental; cloned [1-3], Northern [1], PCR [4], 454 [5], Illumina [6], CLIPseq [7]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
4
PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).
5
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
6
PMID:19460142 "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" Kato M, de Lencastre A, Pincus Z, Slack FJ Genome Biol. 10:R54(2009).
7
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).