Stem-loop sequence hsa-let-7f-2

Accession

MI0000068 (change log)

Previous IDs

hsa-let-7f-2L

Symbol

HGNC:MIRLET7F2

Description

Homo sapiens let-7f-2 stem-loop

Gene family

MIPF0000002; let-7

Literature search

1093 open access papers mention hsa-let-7f-2
(5980 sentences)

Stem-loop

   u      u   gu                uuagggucauac 
5'  guggga gag  aguagauuguauaguu            c
    |||||| |||  ||||||||||||||||             
3'  cacccu uuc  ucaucugacauaucaa            c
   g      -   ug                uagagguucuac 

Deep sequencing

59417479 reads, 1.19e+05 reads per million, 159 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chrX: 53557192-53557274 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from hsa-let-7f-2

• hsa-let-7f-2: chrX: 53557192-53557274 [-]
• hsa-mir-98: chrX: 53556223-53556341 [-]

Database links

• EntrezGene:MIRLET7F2
• HGNC:MIRLET7F2
• RNAcentral:URS000075D19A_9606
• Rfam:let-7
• miRBase Tracker:MI0000068

Mature sequence hsa-let-7f-5p

• Accession: MIMAT0000067
• Previous IDs: hsa-let-7f
• Sequence: 8 - ugagguaguagauuguauaguu - 29
• Deep sequencing: 115380455 reads, 159 experiments
• Evidence: experimental; cloned [1,3-5], Northern [1], Illumina [6]
• Database links:
  • RNAcentral:URS00003B7674_9606
• Predicted targets:
  • TargetMiner:hsa-let-7f-5p
  • TargetScanVert:hsa-let-7f-5p
  • miRDB:hsa-let-7f-5p
  • microrna.org:hsa-let-7f-5p

Mature sequence hsa-let-7f-2-3p

• Accession: MIMAT0004487
• Previous IDs: hsa-let-7f-2*
• Sequence: 58 - cuauacagucuacugucuuucc - 79
• Deep sequencing: 16429 reads, 156 experiments
• Evidence: experimental; cloned [4]
• Database links:
  • RNAcentral:URS00001C04A2_9606
• Predicted targets:
  • TargetMiner:hsa-let-7f-2-3p
  • TargetScanVert:hsa-let-7f-2-3p
  • miRDB:hsa-let-7f-2-3p
  • microrna.org:hsa-let-7f-2-3p

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
6. PMID:20158877 "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha" Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V BMC Genomics. 11 Suppl 1:S6(2010).