miRBase entry: hsa-mir-19b-2

Stem-loop hsa-mir-19b-2


Accession
MI0000075
Symbol
HGNC: MIR19B2
Description
Homo sapiens hsa-mir-19b-2 precursor miRNA
Gene family
MIPF0000011; mir-19

Literature search
282 open access papers mention hsa-mir-19b-2
(1248 sentences)

Sequence

857290 reads, 12558 reads per million, 143 experiments
acauugcuacuuacaauuAGUUUUGCAGGUUUGCAUUUCAgcguauauauguauauguggcUGUGCAAAUCCAUGCAAAACUGAuugugauaaugu
((((((....((((((((((((((((((((((((((....(((((((....)))))))....))))))).)).)))))))))))))))))))))))

Structure
      cuac                 -  -       UUCA       u 
acauug    uuacaauuAGUUUUGCA GG UUUGCAU    gcguaua a
||||||    ||||||||||||||||| || |||||||    |||||||  
uguaau    aguguuAGUCAAAACGU CC AAACGUG    uguauau u
      ----                 A  U       Ucgg       g 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chrX: 134169671-134169766 [-]
Clustered miRNAs
5 other miRNAs are < 10 kb from hsa-mir-19b-2
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-19b-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-19b-2 is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-19b-2 is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-19b-3p

Accession MIMAT0000074
Description Homo sapiens hsa-miR-19b-3p mature miRNA
Sequence 62 - UGUGCAAAUCCAUGCAAAACUGA - 84
Evidence experimental
cloned [1-3,6-9], Northern [1,5]
Database links
Predicted targets

Mature hsa-miR-19b-2-5p

Accession MIMAT0004492
Description Homo sapiens hsa-miR-19b-2-5p mature miRNA
Sequence 19 - AGUUUUGCAGGUUUGCAUUUCA - 40
Evidence experimental
cloned [8]

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  3. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  4. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  5. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  6. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  7. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  8. PubMed ID: 11914277
    miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
    "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
    "Genes Dev (2002) 16:720-728

  9. PubMed ID: 15978578
    Identification of human fetal liver miRNAs by a novel method
    "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
    "FEBS Lett (2005) 579:3849-3854