Stem-loop sequence hsa-mir-29a

Accession

MI0000087 (change log)

Previous IDs

hsa-mir-29

Symbol

HGNC:MIR29A

Description

Homo sapiens miR-29a stem-loop

Gene family

MIPF0000009; mir-29

Literature search

662 open access papers mention hsa-mir-29a
(3292 sentences)

Stem-loop

               uuu       c    ucaa 
5' augacugauuuc   ugguguu agag    u
   ||||||||||||   ||||||| ||||    a
3' uauuggcuaaag   accacga ucuu    u
               ucu       -    uuaa 

Deep sequencing

4836737 reads, 1.18e+04 reads per million, 159 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

miR-29a was previously know as miR-29 here and in [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [6].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr7: 130876747-130876810 [-]
• Overlapping transcripts:

  antisense

  OTTHUMT00000338094 ; MKLN1-012; intron 2

  OTTHUMT00000338095 ; MKLN1-013; intron 2

  ENST00000421797 ; MKLN1-012; intron 2

  ENST00000416992 ; MKLN1-013; intron 2

Clustered miRNAs

< 10kb from hsa-mir-29a

• hsa-mir-29b-1: chr7: 130877459-130877539 [-]
• hsa-mir-29a: chr7: 130876747-130876810 [-]

Database links

• EntrezGene:MIR29A
• HGNC:MIR29A
• RNAcentral:URS00004E9304_9606
• Rfam:mir-29
• miRBase Tracker:MI0000087

Mature sequence hsa-miR-29a-5p

• Accession: MIMAT0004503
• Previous IDs: hsa-miR-29a*
• Sequence: 4 - acugauuucuuuugguguucag - 25
• Deep sequencing: 16004 reads, 158 experiments
• Evidence: experimental; cloned [6]
• Database links:
  • RNAcentral:URS0000076995_9606
• Predicted targets:
  • TargetMiner:hsa-miR-29a-5p
  • TargetScanVert:hsa-miR-29a-5p
  • miRDB:hsa-miR-29a-5p
  • microrna.org:hsa-miR-29a-5p

Mature sequence hsa-miR-29a-3p

• Accession: MIMAT0000086
• Previous IDs: hsa-miR-29a
• Sequence: 42 - uagcaccaucugaaaucgguua - 63
• Deep sequencing: 4820720 reads, 159 experiments
• Evidence: experimental; cloned [1-3,5-7], Northern [1,4], Illumina [8]
• Database links:
  • RNAcentral:URS00002F4D78_9606
• Predicted targets:
  • TargetMiner:hsa-miR-29a-3p
  • TargetScanVert:hsa-miR-29a-3p
  • miRDB:hsa-miR-29a-3p
  • microrna.org:hsa-miR-29a-3p

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3. PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4. PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
5. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
6. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
7. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
8. PMID:20158877 "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha" Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V BMC Genomics. 11 Suppl 1:S6(2010).