miRBase entry: hsa-mir-10b

Stem-loop hsa-mir-10b


Accession
MI0000267
Symbol
HGNC: MIR10B
Description
Homo sapiens hsa-mir-10b precursor miRNA
Gene family
MIPF0000033; mir-10

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR10B is a miRNA that is upregulated in both KO and KI mice and negatively regulates spermatid differentiation [PMC10001410]. Mim23-expressing cells show upregulation of tumorigenic miR10a and MIR10B, as well as downregulation of antiproliferative miR129-5p, which is predicted to alter cell growth and invasion properties [PMC3892995].

Literature search
346 open access papers mention hsa-mir-10b
(2018 sentences)

Sequence

1086103 reads, 3750 reads per million, 146 experiments
ccagagguuguaacguugucuauauaUACCCUGUAGAACCGAAUUUGUGugguauccguauagucACAGAUUCGAUUCUAGGGGAAUauauggucgaugcaaaaacuuca
...((((((....(((((.((((((((.((((.(((((.((((((((((.(.(((....))).))))))))))).))))))))).)))))))).)))))....)))))).

Structure
cca      guaa     u        A    G     C          u g   c 
   gagguu    cguug cuauauaU CCCU UAGAA CGAAUUUGUG g uau c
   ||||||    ||||| |||||||| |||| ||||| |||||||||| | |||  
   cuucaa    guagc gguauaUA GGGG AUCUU GCUUAGACAc u aua g
--a      aaac     u        A    -     A          - g   u 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Michael et al. subsequently verified expression of miR-10b in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr2: 176150303-176150412 [+]

Disease association
hsa-mir-10b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-10b-5p

Accession MIMAT0000254
Description Homo sapiens hsa-miR-10b-5p mature miRNA
Sequence 27 - UACCCUGUAGAACCGAAUUUGUG - 49
Evidence experimental
cloned [2-4]
Database links
Predicted targets

Mature hsa-miR-10b-3p

Accession MIMAT0004556
Description Homo sapiens hsa-miR-10b-3p mature miRNA
Sequence 66 - ACAGAUUCGAUUCUAGGGGAAU - 87
Evidence experimental
cloned [3]
Database links
Predicted targets

References

  1. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  4. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540