![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-219a-1 |
|||||
Accession | MI0000296 (change log) | ||||
Previous IDs | hsa-mir-219 | ||||
Symbol | HGNC:MIR219A1 | ||||
Description | Homo sapiens miR-219a-1 stem-loop | ||||
Gene family | MIPF0000044; mir-219 | ||||
Literature search |
![]()
70 open access papers mention hsa-mir-219a-1 | ||||
Stem-loop |
- c --------c c cu u a g a uau 5' ccgc c gggc gcggcuc gau gucca ac caauucucg guc g |||| | |||| ||||||| ||| ||||| || ||||||||| ||| g 3' ggcg g cccg cgccgag cug caggu ug guugagagc cgg c g a cuccaaacc c cc - c a - ccu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the 5' excised miR has been validated in zebrafish, and the 5' end mapped by PCR [2]. The mature products were later validated in human [3]. Two hairpin precursor structures are predicted, mir-219-1 on chromosome 6 (MI0000296) and mir-219-2 on chromosome 9 (MI0000740) [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-219a-5p |
|
Accession | MIMAT0000276 |
Previous IDs | hsa-miR-219 |
Sequence |
21 - ugauuguccaaacgcaauucu - 41 |
Deep sequencing | 3742 reads, 132 experiments |
Evidence | experimental; cloned [3] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-219a-1-3p |
|
Accession | MIMAT0004567 |
Sequence |
62 - agaguugagucuggacgucccg - 83 |
Deep sequencing | 699 reads, 91 experiments |
Evidence | experimental; cloned [3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12624257
"Vertebrate microRNA genes"
Science. 299:1540(2003).
|
2 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|