MIR27B is a microRNA implicated in various biological processes and diseases, including its role as a key inhibitor in thymic involution, as suggested by its interaction with Wnt4 [PMC5933288]. This microRNA has also been observed to be involved in breast cancer progression, where its reduction, induced by CCL18, enhances invasion and migration in cancer cell lines [PMC4653020]. In the context of temporal lobe epilepsy (TLE), MIR27B is part of a chromosomal cluster on chromosome 9 that is hypermethylated compared to controls [PMC9700089]. Furthermore, MIR27B has been identified as a regulator of VEGFC expression and has been associated with the suppression of tumor growth and metastasis in various cancers including gastric cancer, bladder cancer, and hepatocellular carcinoma [PMC7780026]. Lastly, MIR27B may have a role in the regulation of HIV-1 transcription according to recent research findings [PMC3697138].
- - aaca G G ugau u accu cucu aggugcAGAGCUUAGCU AUUG UGAACag ugg |||| |||| ||||||||||||||||| |||| ||||||| ||| u ugga gaga uccaCGUCUUGAAUCGG UGAC ACUUguu gcc g a --ag - - --uc u
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004588 |
| Description | Homo sapiens hsa-miR-27b-5p mature miRNA |
| Sequence | 19 - AGAGCUUAGCUGAUUGGUGAAC - 40 |
| Evidence |
experimental
cloned [4-5] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0000419 |
| Description | Homo sapiens hsa-miR-27b-3p mature miRNA |
| Sequence | 61 - UUCACAGUGGCUAAGUUCUGC - 81 |
| Evidence |
experimental
cloned [2-5] |
| Database links |
|
| Predicted targets |
|
|