miRBase entry: mmu-mir-30d

Stem-loop mmu-mir-30d


Accession
MI0000549
Symbol
MGI: Mir30d
Description
Mus musculus mmu-mir-30d precursor miRNA
Gene family
MIPF0000005; mir-30

Literature search
194 open access papers mention mmu-mir-30d
(1093 sentences)

Sequence

2731826 reads, 4620 reads per million, 107 experiments
aagucugugucUGUAAACAUCCCCGACUGGAAGcuguaagccacagccaagCUUUCAGUCAGAUGUUUGCUGCuacuggcuc
.((((.(((.(.(((((((((...(((((((((((....((....))..))))))))))).))))))))).).))).)))).

Structure
a    u   u U         CCC           guaa  c 
 aguc gug c GUAAACAUC   GACUGGAAGcu    gc a
 |||| ||| | |||||||||   |||||||||||    ||  
 ucgg cau G CGUUUGUAG   CUGACUUUCga    cg c
c    u   C U         --A           --ac  a 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr15: 68341208-68341289 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-30d
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-30d-5p

Accession MIMAT0000515
Description Mus musculus mmu-miR-30d-5p mature miRNA
Sequence 12 - UGUAAACAUCCCCGACUGGAAG - 33
Evidence experimental
cloned [1,3-5], Illumina [6,8]
Database links
Predicted targets

Mature mmu-miR-30d-3p

Accession MIMAT0017011
Description Mus musculus mmu-miR-30d-3p mature miRNA
Sequence 52 - CUUUCAGUCAGAUGUUUGCUGC - 73
Evidence experimental
454 [7], Illumina [8]
Database links
Predicted targets

References

  1. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  4. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  5. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  6. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  7. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  8. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275