miRBase entry: mmu-mir-351

Stem-loop mmu-mir-351


Accession
MI0000643
Symbol
MGI: Mir351
Description
Mus musculus mmu-mir-351 precursor miRNA
Gene family
MIPF0000244; mir-351

Literature search
28 open access papers mention mmu-mir-351
(207 sentences)

Sequence

555688 reads, 1339 reads per million, 104 experiments
cauggcaccuccguuUCCCUGAGGAGCCCUUUGAGCCUGgagugaaaaaaaaaaacaGGUCAAGAGGCGCCUGGGAACuggagaagaguguuaaacuuc
..(((((((((((.(((((..(((.(((.(((((.((((................))))))))).))).)))))))).)))))....))))))......

Structure
----ca      ----     u     UG   A   C     G    gagugaa 
      uggcac    cuccg uUCCC  AGG GCC UUUGA CCUG       a
      ||||||    ||||| |||||  ||| ||| ||||| ||||        
      auugug    gaggu AAGGG  UCC CGG GAACU GGac       a
cuucaa      agaa     C     --   G   A     -    aaaaaaa 


Annotation confidence High
Do you think this miRNA is real?
Comments
The predominant miRNA cloned by Langraf et al. has a 3' terminal U residue, which is incompatible with the genome sequence [1].

Genome context
chrX: 53053255-53053353 [-]
Clustered miRNAs
6 other miRNAs are < 10 kb from mmu-mir-351
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-351-5p

Accession MIMAT0000609
Description Mus musculus mmu-miR-351-5p mature miRNA
Sequence 16 - UCCCUGAGGAGCCCUUUGAGCCUG - 39
Evidence experimental
cloned [1], Illumina [2,4]
Database links
Predicted targets

Mature mmu-miR-351-3p

Accession MIMAT0017042
Description Mus musculus mmu-miR-351-3p mature miRNA
Sequence 58 - GGUCAAGAGGCGCCUGGGAAC - 78
Evidence experimental
454 [3], Illumina [4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275