miRBase entry: hsa-mir-181b-2

Stem-loop hsa-mir-181b-2


Accession
MI0000683
Symbol
HGNC: MIR181B2
Description
Homo sapiens hsa-mir-181b-2 precursor miRNA
Gene family
MIPF0000007; mir-181

Literature search
362 open access papers mention hsa-mir-181b-2
(1596 sentences)

Sequence

455041 reads, 1507 reads per million, 142 experiments
cugauggcugcacucAACAUUCAUUGCUGUCGGUGGGUuugagucugaaucaaCUCACUGAUCAAUGAAUGCAaacugcggaccaaaca
....((((((((.....(((((((((..(((((((((((.((.......)))))))))))))))))))))).....))))).)))....

Structure
cuga   -     cucAA         CU           u  gu 
    ugg cugca     CAUUCAUUG  GUCGGUGGGUu ga  c
    ||| |||||     |||||||||  ||||||||||| ||  u
    acc ggcgu     GUAAGUAAC  UAGUCACUCaa cu  g
acaa   a     caaAC         --           -  aa 


Annotation confidence High
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Its expression was later verified in human BC-1 cells [3]. There are two predicted hairpin precursor sequences in the human genome; mir-181b-1 (MIR:MI0000270) is found on chromosome 1 [1], and mir-181b-2 (MIR:MI0000683) on chromosome 9 [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
chr9: 124693710-124693798 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-181b-2
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-181b-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-181b-5p

Accession MIMAT0000257
Description Homo sapiens hsa-miR-181b-5p mature miRNA
Sequence 16 - AACAUUCAUUGCUGUCGGUGGGU - 38
Evidence experimental
cloned [3-5]
Database links
Predicted targets

Mature hsa-miR-181b-2-3p

Accession MIMAT0031893
Description Homo sapiens hsa-miR-181b-2-3p mature miRNA
Sequence 54 - CUCACUGAUCAAUGAAUGCA - 73
Evidence not_experimental
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  4. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73

  5. PubMed ID: 15800047
    Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells
    "Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR"
    "Proc Natl Acad Sci U S A (2005) 102:5570-5575