miRBase entry: mmu-mir-210

Stem-loop mmu-mir-210


Accession
MI0000695
Symbol
MGI: Mir210
Description
Mus musculus mmu-mir-210 precursor miRNA

Literature search
121 open access papers mention mmu-mir-210
(1268 sentences)

Sequence

81115 reads, 305 reads per million, 106 experiments
ccggggcagucccuccaggcucaggacAGCCACUGCCCACCGCACACUGcguugcuccggacccaCUGUGCGUGUGACAGCGGCUGAucugucccugggcagcgcgaacc
..(((.....)))((((((..((((.(((((.(((..(((((((((.((.(((......))).)).)))))).))).))).))))).))))..))))))...........

Structure
ccggggcaguccc      cu    a     A   CC   -      C  c   gc 
             uccagg  cagg cAGCC CUG  CAC CGCACA UG guu  u
             ||||||  |||| ||||| |||  ||| |||||| || |||   
             gggucc  gucu GUCGG GAC  GUG GCGUGU ac cag  c
--ccaagcgcgac      cu    A     C   -A   U      C  c   gc 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
Mouse mir-210 is predicted [3] based on homology to a reported miR from human (MIR:MI0000286) [1]. Its expression in mouse was later verified independently [2,4].

Genome context
chr7: 141221384-141221493 [-]

Database links

Mature mmu-miR-210-5p

Accession MIMAT0017052
Description Mus musculus mmu-miR-210-5p mature miRNA
Sequence 28 - AGCCACUGCCCACCGCACACUG - 49
Evidence experimental
454 [6], Illumina [7]
Database links
Predicted targets

Mature mmu-miR-210-3p

Accession MIMAT0000658
Description Mus musculus mmu-miR-210-3p mature miRNA
Sequence 66 - CUGUGCGUGUGACAGCGGCUGA - 87
Evidence experimental
cloned [2,4], Illumina [5,7]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  3. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  4. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  5. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  6. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73

  7. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275