miRBase entry: mmu-mir-221

Stem-loop mmu-mir-221


Accession
MI0000709
Symbol
MGI: Mir221
Description
Mus musculus mmu-mir-221 precursor miRNA
Gene family
MIPF0000051; mir-221

Literature search
197 open access papers mention mmu-mir-221
(1432 sentences)

Sequence

981791 reads, 2711 reads per million, 106 experiments
auccaggucuggggcaugaACCUGGCAUACAAUGUAGAUUUCUGUguuuguuaggcaacAGCUACAUUGUCUGCUGGGUUUCaggcuaccuggaa
.(((((((....(((.(((((((((((.(((((((((....((((((((...)))).))))))))))))).))))))).)))).)))))))))).

Structure
a       cugg   a    -       U         AUUU    -    g 
 uccaggu    ggc ugaA CCUGGCA ACAAUGUAG    CUGU guuu  
 |||||||    ||| |||| ||||||| |||||||||    |||| |||| u
 aggucca    ucg aCUU GGGUCGU UGUUACAUC    GAca cgga  
a       ----   g    U       C         ----    a    u 


Annotation confidence High
Do you think this miRNA is real?
Comments
Mouse mir-221 is predicted [2] based on homology to a reported miR from human (MIR:MI0000298) [1]. Its expression was later verified by cloning [3].

Genome context
chrX: 19146294-19146388 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-221
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-221-5p

Accession MIMAT0017060
Description Mus musculus mmu-miR-221-5p mature miRNA
Sequence 20 - ACCUGGCAUACAAUGUAGAUUUCUGU - 45
Evidence experimental
454 [5], Illumina [6]
Database links
Predicted targets

Mature mmu-miR-221-3p

Accession MIMAT0000669
Description Mus musculus mmu-miR-221-3p mature miRNA
Sequence 60 - AGCUACAUUGUCUGCUGGGUUUC - 82
Evidence experimental
cloned [3], Illumina [4,6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  3. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  4. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  5. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73

  6. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275