miRBase entry: mmu-mir-199a-2

Stem-loop mmu-mir-199a-2


Accession
MI0000713
Symbol
MGI: Mir199a-2
Description
Mus musculus mmu-mir-199a-2 precursor miRNA
Gene family
MIPF0000040; mir-199

Literature search
164 open access papers mention mmu-mir-199a-2
(1326 sentences)

Sequence

3291354 reads, 18117 reads per million, 106 experiments
uggaagcuucaggagauccugcuccgucgcCCCAGUGUUCAGACUACCUGUUCaggacaaugccguuguACAGUAGUCUGCACAUUGGUUAgacugggcaagggccagca
.....(((...((...((((((((.(((...(((((((.((((((((.(((.((((......))..)).))))))))))).)))))))...))).)))).))))))))).

Structure
uggaa   uca  aga    -    c   gcC       U        C   U  --  ac 
     gcu   gg   uccu gcuc guc   CCAGUGU CAGACUAC UGU Ca  gg  a
     |||   ||   |||| |||| |||   ||||||| |||||||| ||| ||  ||   
     cga   cc   ggga cggg cag   GGUUACA GUCUGAUG ACA gu  cc  a
----a   ---  ---    a    u   AUU       C        -   u  ug  gu 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
chr1: 162217814-162217923 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-199a-2
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-199a-5p

Accession MIMAT0000229
Description Mus musculus mmu-miR-199a-5p mature miRNA
Sequence 31 - CCCAGUGUUCAGACUACCUGUUC - 53
Evidence experimental
cloned [5], Illumina [6-7]
Database links
Predicted targets

Mature mmu-miR-199a-3p

Accession MIMAT0000230
Description Mus musculus mmu-miR-199a-3p mature miRNA
Sequence 70 - ACAGUAGUCUGCACAUUGGUUA - 91
Evidence experimental
cloned [1,5], Illumina [6-7]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  3. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179

  4. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  5. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  6. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  7. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73