miRBase entry: mmu-mir-19b-1

Stem-loop mmu-mir-19b-1


Accession
MI0000718
Symbol
MGI: Mir19b-1
Description
Mus musculus mmu-mir-19b-1 precursor miRNA
Gene family
MIPF0000011; mir-19

Literature search
136 open access papers mention mmu-mir-19b-1
(781 sentences)

Sequence

232703 reads, 2437 reads per million, 107 experiments
cacuggucuaugguuAGUUUUGCAGGUUUGCAUCCAGCuguauaauauucugcUGUGCAAAUCCAUGCAAAACUGAcugugguggug
((((...(((((((((((((((((((((((((..((((.............)))))))))).)).))))))))))))))))).))))

Structure
    ggu                 -  -      UC    uguau 
cacu   cuaugguuAGUUUUGCA GG UUUGCA  CAGC     a
||||   ||||||||||||||||| || ||||||  ||||     a
gugg   ggugucAGUCAAAACGU CC AAACGU  GUcg     u
    --u                 A  U      --    ucuua 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr14: 115044305-115044391 [+]
Clustered miRNAs
5 other miRNAs are < 10 kb from mmu-mir-19b-1
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-19b-3p

Accession MIMAT0000513
Description Mus musculus mmu-miR-19b-3p mature miRNA
Sequence 54 - UGUGCAAAUCCAUGCAAAACUGA - 76
Evidence experimental
cloned [1-3,5], Northern [2], Illumina [6,8]
Database links
Predicted targets

Mature mmu-miR-19b-1-5p

Accession MIMAT0017065
Description Mus musculus mmu-miR-19b-1-5p mature miRNA
Sequence 16 - AGUUUUGCAGGUUUGCAUCCAGC - 38
Evidence experimental
454 [7], Illumina [8]
Database links
Predicted targets

References

  1. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  4. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  5. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  6. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  7. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73

  8. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275