Stem-loop mmu-mir-133b

Accession

MI0000821

Symbol

MGI: Mir133b

Description

Mus musculus mmu-mir-133b precursor miRNA

Literature search

198 open access papers mention mmu-mir-133b
(1312 sentences)

Sequence

118935 reads, 1590 reads per million, 71 experiments

ccuccaaagggaguggcccccugcucugGCUGGUCAAACGGAACCAAGUCcgucuuccugagaggUUUGGUCCCCUUCAACCAGCUAcagcagggcuggcaaagcucaauauuuggaga
.(((((((..((((.((((((((((.((((((((..((.((.((((((.((.((((...)))))))))))).)).))..)))))))).)))))))..)))...))))....))))))).

Structure

c       --gg    --g   --       c        CA  C  A      U  g    c 
 cuccaaa    gagu   gcc  cccugcu ugGCUGGU  AA GG ACCAAG Cc ucuu  
 |||||||    ||||   |||  ||||||| ||||||||  || || |||||| || |||| c
 gagguuu    cucg   cgg  gggacga AUCGACCA  UU CC UGGUUU gg agag  
a       auaa    aaa   uc       c        AC  C  C      -  -    u 

Annotation confidence High

Comments

miR-133b was predicted based on comparative analysis of human, mouse and Fugu [1]. It is homologous to miR-133a (MIR:MI0000159 and MIR:MI0000820). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

chr1: 20682769-20682887 [+]

Clustered miRNAs

1 other miRNA is < 10 kb from mmu-mir-133b

Mature mmu-miR-133b-5p

• Accession: MIMAT0017083
• Description: Mus musculus mmu-miR-133b-5p mature miRNA
• Sequence: 29 - GCUGGUCAAACGGAACCAAGUC - 50
• Evidence: experimental ; Illumina [5]

Mature mmu-miR-133b-3p

• Accession: MIMAT0000769
• Description: Mus musculus mmu-miR-133b-3p mature miRNA
• Sequence: 66 - UUUGGUCCCCUUCAACCAGCUA - 87
• Evidence: experimental ; cloned [2-3], Illumina [4-5]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 12624257
   Vertebrate microRNA genes
   "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
   "Science (2003) 299:1540


3. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


4. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


5. PubMed ID: 16274478
   Identification of clustered microRNAs using an ab initio prediction method
   Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
   BMC Bioinformatics (2005) 6:267