Stem-loop sequence ath-MIR169b

AccessionMI0000976 (change log)
DescriptionArabidopsis thaliana miR169b stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

34 open access papers mention ath-MIR169b
(177 sentences)

Stem-loop 
        c    u  aa        agu    u      u    c    -     ug           cgu    aac   g       a    gu 
5' cccaa ggag ag  uugcauga   ggag agagua aaug agcc aagga  acuugccggaa   uguu   cau cauauga uaau  g
   ||||| |||| ||  ||||||||   |||| |||||| |||| |||| |||||  |||||||||||   ||||   ||| ||||||| ||||   
3' ggguu ccuu uc  aacguacu   cuuc ucucgu uuac ucgg uuccu  ugaacggucuu   acaa   gua guguauu auua  a
        -    -  -a        cuu    -      u    a    c     gu           uau    ---   -       a    gu
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR169 family [1]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors.

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 8527469-8527649 [+]
intergenic
Database links

Mature sequence ath-miR169b-5p

Accession MIMAT0000906
Previous IDsath-miR169b
Sequence

43 -  

cagccaaggaugacuugccgg

 - 63

Get sequence
Evidence experimental; Northern [2], cloned [3], 454 [4-5], MPSS [4], Illumina [6]

Mature sequence ath-miR169b-3p

Accession MIMAT0031897
Sequence

124 -  

ggcaaguuguccuucggcuaca

 - 145

Get sequence
Evidence not experimental

References

1
PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2
PMID:15345049 "Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets" Wang XJ, Reyes JL, Chua NH, Gaasterland T Genome Biol. 5:R65(2004).
3
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
6
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).