Stem-loop ath-MIR393b

Accession

MI0001004

Description

Arabidopsis thaliana ath-MIR393b precursor miRNA

Literature search

31 open access papers mention ath-MIR393b
(79 sentences)

Sequence

agagaaaggaUCCAAAGGGAUCGCAUUGAUCCuaauuaagcugauuuauuccccaauaauuguuuuuuuuuuccuucucaaucgaaagauggaagaaaaacaaauuccaaacauuuugcuuacuuuuccggAUCAUGCGAUCUCUUUGGAUUcauucuuu
.(((((.(((((((((((((((((((.(((((.((.(((((....(((((....)))))(((((((((..((((.(((........))).)))))))))))))..............)))))..))...)))))))))))))))))))))))).))))).

Structure

a     a                   U     --u  -u     ugauuuauuccccaauaa         uu    u   caa 
 gagaa ggaUCCAAAGGGAUCGCAU GAUCC   aa  uaagc                  uuguuuuuu  uucc ucu   u
 ||||| ||||||||||||||||||| |||||   ||  |||||                  |||||||||  |||| |||    
 uucuu cUUAGGUUUCUCUAGCGUA CUAgg   uu  auucg                  aacaaaaag  aagg aga   c
u     a                   -     ccu  uc     ----uuuuacaaaccuua         --    u   aag 

Annotation confidence Low

Comments

This sequence belongs to the miR393 family of miRNAs, which are predicted to target mRNAs coding for F-box proteins and bHLH transcription factors [1].

Genome context

chr3: 20691647-20691806 [+]

Mature ath-miR393b-5p

• Accession: MIMAT0000935
• Description: Arabidopsis thaliana ath-miR393b-5p mature miRNA
• Sequence: 11 - UCCAAAGGGAUCGCAUUGAUCC - 32
• Evidence: experimental ; 5'RACE [1], Northern [1-2], PCR [1], cloned [2], 454 [3], MPSS [3-4]

Mature ath-miR393b-3p

• Accession: MIMAT0031906
• Description: Arabidopsis thaliana ath-miR393b-3p mature miRNA
• Sequence: 132 - AUCAUGCGAUCUCUUUGGAUU - 152
• Evidence: experimental ; Illumina [5]

References

1. PubMed ID: 16954541
   MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
   "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
   "Genome Res (2006) 16:1276-1288


2. PubMed ID: 17182867
   A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
   "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
   "Genes Dev (2006) 20:3407-3425


3. PubMed ID: 15200956
   Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
   "Jones-Rhoades MW, Bartel DP"
   "Mol Cell (2004) 14:787-799


4. PubMed ID: 15258262
   Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis
   "Sunkar R, Zhu JK"
   "Plant Cell (2004) 16:2001-2019


5. PubMed ID: 24119003
   Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots
   Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutiérrez RA
   BMC Genomics (2013) 14:701