Stem-loop sequence ath-MIR398a

AccessionMI0001017 (change log)
DescriptionArabidopsis thaliana miR398a stem-loop
Gene family MIPF0000107; MIR398
Literature search

31 open access papers mention ath-MIR398a
(116 sentences)

Stem-loop 
   ugaaau        a     a  u       --ua  cu        uucaaa 
5'       uucaaagg guggc ug gaacaca    uc  augguuuc      u
         |||||||| ||||| || |||||||    ||  ||||||||       
3'       aaguuucc cacug ac cuugugu    ag  uaccaaag      u
   cccucu        c     g  u       uuug  -u        uuaccu
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR398 family of miRNAs, which are predicted to target mRNAs coding for copper superoxide dismutases and cytochrome C oxidase subunit V [1].

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr2: 1040938-1041042 [+]
intergenic
Database links

Mature sequence ath-miR398a-5p

Accession MIMAT0031910
Sequence

11 -  

aaggaguggcaugugaacaca

 - 31

Get sequence
Evidence experimental; Illumina [5]

Mature sequence ath-miR398a-3p

Accession MIMAT0000948
Previous IDsath-miR398a
Sequence

75 -  

uguguucucaggucaccccuu

 - 95

Get sequence
Evidence experimental; 5'RACE [1], Northern [1], PCR [1], cloned [2], 454 [3-4], MPSS [3]

References

1
PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2
PMID:15258262 "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis" Sunkar R, Zhu JK Plant Cell. 16:2001-2019(2004).
3
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
4
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
5
PMID:24119003 "Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots" Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutierrez RA BMC Genomics. 14:701(2013).