Stem-loop sequence gga-mir-34a

Accession

MI0001251 (change log)

Description

Gallus gallus miR-34a stem-loop

Gene family

MIPF0000039; mir-34

Literature search

16 open access papers mention gga-mir-34a
(52 sentences)

Stem-loop

   --g     --    -  ug     uu        -   a          --gug   a 
5'    ccagc  ugug ag  uuucu  ggcagugu cuu gcugguuguu     agc a
      |||||  |||| ||  |||||  |||||||| ||| ||||||||||     |||  
3'    gguug  acac uc  gaaga  ccgucaua gaa cgacuaacga     uug u
   ccg     uu    a  gu     uc        u   -          aggaa   a 

Deep sequencing

4119 reads, 0 reads per million, 5 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Gallus_gallus-5.0; GCA_000002315.3): chr21: 3262992-3263100 [-]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:
• RNAcentral:URS000075CFEB_9031
• miRBase Tracker:MI0001251

Mature sequence gga-miR-34a-5p

• Accession: MIMAT0001173
• Sequence: 21 - uggcagugucuuagcugguuguu - 43
• Deep sequencing: 4067 reads, 5 experiments
• Evidence: experimental; cloned [2], Illumina [3]
• Database links:
  • RNAcentral:URS00001646B5_9031
• Predicted targets:
  • TargetScanVert:gga-miR-34a-5p
  • miRDB:gga-miR-34a-5p

Mature sequence gga-miR-34a-3p

• Accession: MIMAT0026535
• Sequence: 64 - caaucagcaaguauacugcccua - 86
• Deep sequencing: 47 reads, 5 experiments
• Evidence: experimental; Illumina [3]
• Predicted targets:
  • TargetScanVert:gga-miR-34a-3p
  • miRDB:gga-miR-34a-3p

References

1. PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2. PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3. " McBride D, Carre W, Law A, Clinton M Unpublished.
4. PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
5. PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).