MIR423 is one of the 16 candidate miRNAs that have been studied for their potential involvement in diabetes [PMC7463887]. It is a type of miRNA that has been found to be altered in the plasma/serum of diabetic patients [PMC7463887]. In a study involving 47 T2D patients and 22 healthy subjects, the expression of MIR423, along with other miRNAs such as mir29a, mir34b, Xpo5, and several others, was found to be significantly different in leukoplakia tissues compared to control tissues [PMC4035900]. However, the expression of these genes was not modulated by genotypes at SNPs [PMC4035900]. This study aimed to investigate the potential involvement of these candidate miRNAs in diabetic retinopathy [PMC7463887]. The researchers analyzed plasma/serum samples from T2D patients with and without retinopathy as well as healthy subjects [PMC7463887'>PMC7463887]. The findings suggest that MIR423 and other miRNAs may play a role in the development or progression of diabetic retinopathy [PMC7463887]. Further research is needed to fully understand the mechanisms by which these miRNAs contribute to the pathogenesis of diabetes and its complications [PMC7463887].
-----auaa u -AG G A cua aggaagu aggcUGAGGGGC AGA CGAG CUUUu u ||||||| |||||||||||| ||| |||| ||||| u uccuucg ucUGACUCCCCG UCU GCUC GAaaa u cgcgcccaa u GAG G - ccu
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004748 |
Description | Homo sapiens hsa-miR-423-5p mature miRNA |
Sequence | 17 - UGAGGGGCAGAGAGCGAGACUUU - 39 |
Evidence |
experimental
cloned [2-4], Northern [4], Illumina [5] |
Database links | |
Predicted targets |
Accession | MIMAT0001340 |
Description | Homo sapiens hsa-miR-423-3p mature miRNA |
Sequence | 53 - AGCUCGGUCUGAGGCCCCUCAGU - 75 |
Evidence |
experimental
cloned [1-2], Northern [1] |
Database links | |
Predicted targets |
|