miRBase entry: hsa-mir-423

Stem-loop hsa-mir-423


Accession
MI0001445
Symbol
HGNC: MIR423
Description
Homo sapiens hsa-mir-423 precursor miRNA mir-423
Gene
family?
RF00870; mir-423

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR423 is a microRNA, a small non-coding RNA molecule, which is involved in the regulation of gene expression [PMC7463887]. It was not found to be modulated by genotypes at single nucleotide polymorphisms (SNPs) in a study comparing its expression in leukoplakia tissues to control tissues [PMC4035900]. However, its expression was significantly different when leukoplakia tissues were compared with control tissues, suggesting a potential role in the pathogenesis of this condition [PMC4035900]. Additionally, MIR423 was included in a panel of 16 candidate microRNAs that were previously reported to be altered in the plasma/serum of diabetic patients [PMC7463887]. This panel was analyzed to assess the potential involvement of these microRNAs in diabetic retinopathy among type 2 diabetes (T2D) patients with varying degrees of retinopathy and healthy subjects [PMC7463887]. The study aimed to understand better the molecular mechanisms underlying diabetic complications and potentially identify biomarkers for disease progression and prognosis [PMC7463887].

Literature search
111 open access papers mention hsa-mir-423
(452 sentences)

Sequence

1378741 reads, 3190 reads per million, 159 experiments
auaaaggaaguuaggcUGAGGGGCAGAGAGCGAGACUUUucuauuuuccaaaAGCUCGGUCUGAGGCCCCUCAGUcuugcuuccuaacccgcgc
....(((((((.((((((((((((..(((.((((.(((((.........))))))))).)))...)))))))))))).))))))).........

Structure
-----auaa       u            -AG   G    A     cua 
         aggaagu aggcUGAGGGGC   AGA CGAG CUUUu   u
         ||||||| ||||||||||||   ||| |||| |||||   u
         uccuucg ucUGACUCCCCG   UCU GCUC GAaaa   u
cgcgcccaa       u            GAG   G    -     ccu 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
miR-423 (renamed miR-423-3p here) is expressed in human promyelocytic leukemia (HL-60) cells [1]. The level of expression was shown to be up-regulated 48 hours after TPA-induction. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chr17: 30117079-30117172 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-423
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-423 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-423-5p

Accession MIMAT0004748
Description Homo sapiens hsa-miR-423-5p mature miRNA
Sequence 17 - UGAGGGGCAGAGAGCGAGACUUU - 39
Evidence experimental
cloned [2-4], Northern [4], Illumina [5]
Database links
Predicted targets

Mature hsa-miR-423-3p

Accession MIMAT0001340
Description Homo sapiens hsa-miR-423-3p mature miRNA
Sequence 53 - AGCUCGGUCUGAGGCCCCUCAGU - 75
Evidence experimental
cloned [1-2], Northern [1]
Database links
Predicted targets

References

  1. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  4. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6

  5. PubMed ID: 18230126
    New miRNAs cloned from neuroblastoma
    "Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F"
    "BMC Genomics (2008) 9:52